My first post this year was 1/3/24 on my one year CALR+versary. My unrelated traumatic incident occurred on 3/3/24 and my next post was on 6/3/24. I was feeling like I wanted to write an update recently and really wanted to make it for 12/3/24. I stressed myself out trying to get this written to post on that date. But my work demands were in semi-explosion mode recently and on 12/3/24 itself I worked quite late, actually since I was going to be out for appointments on 12/4/24 related to “mybloodmatters.” Javi was like, you can just make it short, and I was like, I need to make it complete. I simply didn’t have the energy physically or mentally to try even starting.
You’re probably asking why in the world I would stress about those dates and posting to match. Some of you know one of my special interests is finding patterns and meaning in dates. I admit getting upset about not making the pattern I wanted in this year’s entries is pointless neuroticism gone too far. Are there not actually a great deal of more important things to be concerned about in the present, etc. Also if I want to indulge my brain with numerical matchy-matchy there’s an option to wait to update on 1/3/25, my next CALR+versary.
But I haven’t updated in so long, though there have been things to say along the way this year. And it’s still easier to write, much harder for me to express in person what is happening related to my health. This year it’s become surprisingly hard continuing to communicate my situation, even in writing. Things have been happening externally around me, and internally within me. Some of the stuff is so complex I haven’t really figured out fully myself and/or how to say it to a wide audience. I guess that’s the problem with starting a semi-public blog about it, oops. Still it’s time to update what’s been going on vs. being incommunicado.
So here I am posting on 12/12/24 as a consolation prize to myself. Because that’s a pretty cool date in terms of patterns on its own.
Things are fine, also not fine. I have a tendency of saying I’m fine and trying to act fine. People think I’m fine. I think?
I attended a conference on MPNs in late October which was pretty wild and informative. A lot of the major MPN experts were there. I was kind of feeling like seeing celebrities almost, after watching them on videos, mentioned in research forums, and on the byline of research papers.
The fact that MPNs are usually an older people disease hit hard at this conference. I kept going up to people who looked younger (relatively) being like, are you a patient? And they were all, no, I’m a nurse, or no, I’m a research assistant, or no, I’m a pharmaceutic company rep. It was kind of like I was little out of place kid or animal looking for one of my kind and bumping around not finding one. (Will you be my friend?) To be fair, there were a few younger patients. And, it was also very nice to interact with the older people too. Many were so kind, some almost with a pity-ing reaction, and some gave me some unsolicited but lovely advice.
Another update is I have been transitioning my care back to MSK for a couple reasons, which I can explain to people offline if you’re interested. I am seeing Dr. Raajit Rampal as my hematologist/oncologist now. He’s pretty badass, I must say. Here’s him at the conference I attended, explaining what happens with blood cells when they go wrong. If you so dare, watch from the link time stamp, up maybe to 17:00, or if you’re really feeling it, to 22:00 for some totally titillating talk on mutations.
This is the chart he shows and explains in the talk. I found it so incredible that I have it printed and up on the fridge right now. But it’s basic science, just very new to me. And yes, it is a bit weird to have on the fridge.

As you may know from previous blog reports, my eosinophils have been fully out of control for a while, and my atypical megakaryocytes and high platelets are screwing up these days.
What’s really crazy is apparently possibly eosinophils come actually from a different progenitor than CFU-GEMM, i.e. they morph into their own thing directly from the stem cell, even earlier than my fridge chart shows, and they have their own mechanism outside of the CFU-GEMM in the progenitor phase.

So regarding mutations, probably this means nothing much to anyone. But I am starting to understand some.
My mutation allelle burdens (NGS) according to the BMB analysis dates (love all the 1-2-3 date action by the way):
1/23/23 CALR 5.2%
2/23/23 CALR 7.8% TP63 9.4%
3/31/23 CALR 12.1% TP63 11%
Those percentages are how many cells are show to be manifesting the mutations. And then:
CALR FRAMESHIFT (NM_004343) exon9 p.K368Rfs*51 (c.1103_1136delAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGA)
TP63 MISSENSE (NM_003722) exon5 p.E239D (c.717G>T)
That gobbledygook are the exact parts of the genetic code that are going wrong in my body.
Eosinophils, which were my first manifestation of a problem, are now very low. That makes sense because I am injecting Nucala (Mepolizumab) monthly since May and that is eradicating the precursor cytokine (IL5).
My platelets are trending upwards now, most recently 760. That is typical progression of Essential Thrombocythemia (ET).

After I a consultation with Dr. Rampal on 9/4/24, I kind of had a mental breakthrough after reading the notes he wrote. I underlined the relevant part.

I remember that statement coming out of my mouth. I think I said “but you know things are ok and generally my life is good.” He didn’t ask for it and my brain even kind of was like thinking internally “why are you saying this” when I said it. I volunteered it at the end of a diatribe, going through a list of more negative things/complaints that I kept in my iphone notes.
What I realized is that I may need to be more honest with myself and with everyone including the doctors. It’s kind of a mental tic of mine to proactively insert verbal minimizing/cushion phrases after I say something negative, particularly when it relates to how I’m doing. I have always wanted to be unproblematic and have at times tried to hide my suffering in an attempt to not be concerning or bothersome. Which, if you can relate at all, may know, generally ends up with bad results. At present, if I’m truly honest with myself, and that’s taken me a while….my quality of life has become concerning to me.
I feel mentally/emotionally stable overall, like not mental health problems. However I am increasingly concerned about my cognitive ability, most in concentration and memory. I am equally concerned about my energy level decreasing more rapidly than it seems like normal aging. I keep trying to keep up, as always prioritizing work over everything else and it’s getting harder at work as well. I am unable to be actively engaged in my personal life and accomplish what I need and want due, to exhaustion both physically and cognitively. The Modafinil medication for fatigue mentioned in Dr. Rampal’s notes actually didn’t end up working out because it made me full of rage inside. I’d rather be exhausted than angry.
There are other unpleasant symptoms I’m having: almost daily and multiple per day diarrhea spells, sometimes with nausea, burning pain in the backs of my hands, burning in my ankle, numbness in my feet and fingers, ringing in my ears, dizzy spells, itchiness, dull bone pain in my lower leg, and frequent infections requiring antibiotics be it small cuts, bug bites, UTI. I get weird dark red eye circles which don’t hurt but look freaky. I bleed and bruise really easily, my lips split and bleed sometimes when I’m talking or smiling, and sometimes I don’t notice until other people do.
My pulmonary symptoms have taken a turn for the worse recently. Very severe shortness of breath, chest tightness, wheezing, needing the rescue inhaler a lot again with exercise and cold weather. Wheezing at night, waking up from my sleep from it. The Mepolizumab isn’t taking the edge off anymore. I might need to add the Breo cortosteroid back at the same time now.
Interferon is the first line of treatment as indicated by the NCCN MPN guidelines for treatment in the United States. The interferon indicated for ET is called Pegasys (pegylated interferon alpha). It is not without risk of some nasty side effects. If this Pegasys treatment line doesn’t work well for me/I can’t tolerate it, then they might consider a different type of medication called Jakafi. From what I understand from reading between the lines, Jakafi is second-line for insurance companies to approve, because it’s crazy expensive. (denydefendepose?)
Some people in my life are not wild about the idea of me starting interferon. Understandable, given the possible side effects, and when you google it, you find stuff on Hepatitis C, which is the major and original use for the medication. But it’s the normal and available line of treatment for me. While I do not really want to take it, I also think it’s in my best interest to proceed. Check this from MPN expert Dr. Hasselbalch, maybe from the link timestamp up to 20:00 if you really want to go hard, but a few minutes will suffice too.
Recently I’ve had consultation with, been seen by, and and run tests with MSK speciality pharmacy, pulmonology, neurology, opthamology, psych, and supportive care. Plus of course hematology/oncology. Under the care of Dr. Rampal, I’m getting ready to go on interferon potentially in the new year. Probably I will advocate for it to be in the second quarter of 2025, due to a family trip I want to participate in before I suffer any possible side effects. I am happy things are getting consolidated at MSK. There are some hangups with the Mepolizumab situation getting moved over, but I’m doing my best health care administration patient advocacy attempts and hopefully that will get resolved.
Here are some other things I would like to share:
This MPN voice webpage is from the UK, it’s way better than any US website I’ve found, in terms of useful and comprehensive info and also very patient-resonating content, such as this. I am feeling this quite a bit lately.
And kind of related, I really appreciated what MPN expert Dr. Mesa said here, maybe useful up to 18:25. In the conference when he said, “I know what you guys go through…,” it felt so meaningful to me in the moment.
Finally, this was my own pre-submitted question at the conference, which I was kind of freaking out that Dr. Abu-Zeinah directed to the pioneer of MPN research and interferon treatment in the 80s, Dr. Silver, for whom the Weill-Cornell Silver MPN Center was named (to 39:25).
So probably anyone reading has already completely zoned out on the weird science and that’s ok. I’m just real deep in it at this point. At the cellular level, it’s in me, it’s me. It’s weird in my genetic code, in my stem cells, in my bone marrow, in my blood. I’m trying to understand it, understand myself, and want others to understand me, and understand it. At some point I have to accept that other people in my orbit may not understand it, some may not believe it, some may not care to, some may not want to.
The internal workings of my body, the manifesting symptoms, the external impacts those have, the judgements of others, the confusion, the silence, the lack of clarity, the questions that have no answers, those are all things that I cannot control. But what I can control are my choices on how I deal with this.
Leave a reply to kevin Cancel reply